Primer name Sequence (5'-3') Target gene Gene annotation
Bacteroid
mll9289F TCTCAATTGCGCGGAAAAG mll9289 Unknown
mll9289R ATTCTGCCGCCCCGA
mlr5943F TCGTTGCGAAATACCCCAA mlr5943 L-2,4-Diaminobutyric acid transaminase
mlr5943R GCCGGCCATCAGACCAC
mlr6282F TGCCTGTTGATCCATCGGA mlr6282 Phosphinothricin tripeptide synthetase B
mlr6282R TGGCGTTCGTGTTGCG
mlr5972F AAATGGGTGCGCGATCTG mlr5972 Transposase
mlr5972R ATCTGCCCGTGGCCG
mll6075F GCTGATGACGATGATCGCCT mll6075 Transposase
mll6075R CCCCTCCCGCTTGTTTG
mll9123F TTCTGCGCCCCGGC mll9123 NTA monooxygenase component A
mll9123R ATCGGAATGCGCGTTCATA
mlr5876F TTGAGCTCGATCCACCGG mlr5876 Cytochrome P450
mlr5876R GCGAAAGCAGCGGACTGA
mlr5906F CCGCGGCGTTTCACA mlr5906 nifD
mlr5906R AATCGCGGATCGCATCATT
mlr5932F GTTTTTTTCCAGCGGGCTC mlr5932 1-Aminocyclopropane-1-carboxylate deaminase
mlr5932R TTGATGGCCGGCGC
mlr7226F TTCCAAGATCGAATGGTTTTCC mlr7226 Sugar ABC transporter, permease protein
mlr7226R TGGCGAAGGTGACGGC
mll3068F CCAGAATGATGCGGGTGAG mll3068 Sulfate ABC transporter, permease protein
mll3068R TCGACGGCTGCGCC
mll3069F ACAAGGACCTGGTGAAGGTTTC mll3069 ABC transporter, periplasmic binding protein
mll3069R TTGGCGAATTCCGGCTT
mll2921F CGGTCGGAAACGCTTGAA mll2921 flgH
mll2921R CGTTCGGCAAGACGTCG
mlr9251F TCGTCAAGCGCAATGACGT mlr9251 Conjugal transfer protein
mlr9251R ATTGACAAGCTGCACCAGGAA
mlr6617F TCCTGGACACACGCCAGAT mlr6617 Two-component system, regulatory protein
mlr6617R CGAAAGCGCAACGGGA
mll0870F CCGCGATCTGGCCGA mll0870 DNA polymerase III alpha subunit
mll0870R CCAATTCGACATAGAGCCGG
mlr0325F CATCAAGGAGATCGCCATCC mlr0325 DNA-directed RNA polymerase alpha subunit
mlr0325R TTGCGCACGACCATGC
mll6624F TCGTCGCTGCTTGTCATTG mll6624 fixI
mll6624R CCGGTGAATTTGGCATCG
mlr6417F CGTGATGGTCAAGGACGGA mlr6417 fixI
mlr6417R TCGAATACCGCCACGTCTATC
mlr6210F ATCCGGTCGACACGCGT mlr6210 Glutamine synthetase III
mlr6210R CCAGTCGCGCTCAGCAA
mll7254F ATGTGGCGGAGATTTTCCC mll7254 Glutamine synthetase
mll7254R CCTGGCGTTTGCAGGC
Microaerobic
mll5857F TCATATGCGCCACCAACAA mll5857 nifA
mll5857R GCACCACATTGATGCGGTAATA
mll6593F GCCTCTTCGATTGCATCGAA mll6593 Hypothetical protein
mll6593R AGAAGGCAAGGTCGTACAGAACA
mll6600F TGGTCTTCACCTCTGGCTTTGT mll6600 5-Aminolevulinic acid synthase
mll6600R ATCATCGAGGCGTGGTTCA
mll6607F TTACAGCACTCGGCGAAATG mll6607 fixL
mll6607R TGCCTTTGAGGTAGTTCGTGATC
mll6630F GAGCCTTTCCGACAGCATATGT mll6630 fixN
mll6630R ACTTGTGTTGCGCAGAAGAACA
mll6639F ATGCAATATGCCAGCCAGAAC mll6639 Aldehyde dehydrogenase
mll6639R CAGCGCGAACATGACGAA
mlr5905F CGTCATCACCTCGATCAACTTC mlr5905 nifH
mlr5905R CCAGCACGTCGTAGGAGACATA
mlr6411F CGTCGTTCTAAGCCTGTTTGCT mlr6411 fixN
mlr6411R CTGTGTTGCGCAGCAGGAT
mlr6580F TGTATGGAAGTGGACAGGTCTCA mlr6580 Serine/threonine kinase
mlr6580R TGCGAAACAGGCTGGTGAT
mlr6618F GATACTGGTTCCGGCAACCTT mlr6618 Two-component sensor protein
mlr6618R GCCCCTTGAATTCCTTGATCTC
mlr6622F CAGGAACTTGCGGACATCTATG mlr6622 Nodulin 21
mlr6622R GCCGTTGTCATCTCCGAAAT
mlr6633F CGGCGTTCAGGATTTCGAT mlr6633 Anaerbic coproporphyrinogen III oxidase
mlr6633R CTCTTGGTCAGCAGGAAGCTTT
Starvation
mll6527f1 TGCTCGCCCTCGTTCAACTG mll6527 Isocitrate lyase
mll6527r1 GAGCGTGATGAACTGGAACTTGTAG
mll3076f AGCGACAGCAGACGGATACC mll3076 Hypothetical protein
mll3076r CCAGCCTCTCCTCGACGATG
mlr4771f GAACTCTACAAGAAGGGCAACC mlr4771 Secreted sugar-binding protein
mlr4771r AGATGAAGCCGTGGATGACC
mlr2341f CGTACCGATGCTCTCCGATGC mlr2341 Hypothetical protein
mlr2341r AGGACGGCACGCCATAATTGAC
mlr2339f GACAAGTCGTCGCCATATCTGAAG mlr2339 Hypothetical protein
mlr2339r CGCTGGTCTCGCCGTCAATG
mll1629f GCTGCCTGCGACTATTCCTTCC mll1629 Dihydropyrimidinase
mll1629r TCTCGTCGTCGTCCACCATCAG
mll1631f CCAGTACAAGGTCGAGCAGGTC mll1631 N-Carbamoyl-beta-alanine amidohydrolase
mll1631r CGATGTTGCGGTGCGTATAGC
mll3075f GCCTGTTGCTGCCGATCTATACG mll3075 Amino acid/metabolite permease
mll3075r CCGACCAGACGACCGACATGAC
mll1644f2 TGCCACGCCCGACGACTATC mll1644 Sterol methyltransferase
mll1644r2 GCTTCTTGCCCTCCGCTTGC
mll0710f2 CGCTTCGTGCTGCCCTATGC mll0710 Glycerol-3-phosphate dehydrogenase
mll0710r2 GCTTGCCATGTCGAGTGTCCTG
mlr2338f CGCTCCGAGCGACGACCATC mlr2338 Hypothetical protein
mlr2338r CGCCAGGTGCCTTCCATCTCC
mlr1634f CCGCCGCAAGGAAGACATTCAC mlr1634  Transcriptional regulator
mlr1634r CGCAGCTCAGTCATCGGATCG
mll3795f ACGACATCGCCAAGGCTAGG mll3795 Transcriptional regulator
mll3795r GATCGGAACAACCAGGCACATC
mll4697f AGATAGTGATTGCTGACGACCATCC mll4697 Two-component system response regulator
mll4697r ACCGCTGTCTCGCCATTGTC
mll4698f CAGTCTCAGCCGAAGCGTCAAAGC mll4698 Two-component system histidine protein kinase
mll4698r GTGCCGCCGCCAACCCAAAG
mll6710f CAGCCGCAGGACCGTGATAG mll6710 Transcriptional regulator
mll6710r CGAGCGTTGAAAAGGACAGAGG
mlr0480f CGCTTCCGAGCCTCTACCACTAC mlr0480 Unknown protein
mlr0480r CACTGTTGCCGCTCACCGTTAG
mlr0479f2 GCTTCGCCTCGTGCTGGTGAC mlr0479 exoI
mlr0479r2 GGAAATGGCTACTGGCTTTGGCTTG
mlr2852f CCTTGGCGTGCTGATCTATG mlr2852 Cardiolipin synthase
mlr2852r GCTCATTCTTGGCGGATACC
Standard
MLsigAf1 GCCCTCTGCTCGACCTTTCC mll2466 sigA
MLsigAr1 AGCATCGCCATCGTGTCCTC
Other
MLsym1 GGAGGTTATGCTGGGAAAATGAGTTGCAGC mlr8755 nodA
MLsym2 TGGTCCTGGCTCAAAACTCTTCTACCTGC mlr6164 nodI
MLsym3 CTCGATGACAGATGGAAGGTGCAGAG mlr6175 nodB
MLsym4 GTCACGGTATGCGAATTGCCTGCCA
MLsym5 TGGGAGGCAGATCGAGGTACACGTC mlr8755 nodA
MLnodD1 GCAGCATCAACCTTAGTCAGCCG mll6179,mlr6182 nodD1, nodD2
MLnodD2 ACGAGCTGTGCCTGAGACCATC
MLsigA1 AAGAAAGAGCCGACTGACCGCACCGA mll2466 sigA
MLsigA2 GACCGAGAACTGCTGGCCGACTTCTT
MLsigA3 GGGGTACCCAGCTTTACGACATCAACAAGCGCCTGG
  MLsigA4 CGGGATCCTGACCGAGAACTGCTGGCCGACTTCT